# STOCKHOLM 1.0 #=GF ID TLS-PK2 #=GF AC RF01077 #=GF DE Pseudoknot of tRNA-like structure #=GF AU Wilkinson A; 0000-0001-7406-0151 #=GF GA 42.0 #=GF NC 39.5 #=GF TC 88.8 #=GF SE Pseudobase #=GF SS Pseudobase #=GF TP Cis-reg; #=GF BM cmbuild -F CM SEED #=GF CB cmcalibrate --mpi CM #=GF SM cmsearch --cpu 4 --verbose --nohmmonly -T 29.29 -Z 2958934 CM SEQDB #=GF DR PKBASE; PKB00139; #=GF DR PKBASE; PKB00057; #=GF DR SO; 0005836; regulatory_region; #=GF DR GO; 0045069; regulation of viral genome replication; #=GF RN [1] #=GF RM 16453568 #=GF RT The three-dimensional folding of the tRNA-like structure of tobacco mosaic #=GF RT virus RNA. A new building principle applied twice. #=GF RA Rietveld K, Linschooten K, Pleij CW, Bosch L #=GF RL EMBO J. 1984;3:2613-2619. #=GF RN [2] #=GF RM 1935928 #=GF RT tRNA-like structures. Structure, function and evolutionary significance. #=GF RA Mans RM, Pleij CW, Bosch L #=GF RL Eur J Biochem. 1991;201:303-324. #=GF RN [3] #=GF RM 8608444 #=GF RT A central pseudoknotted three-way junction imposes tRNA-like mimicry and #=GF RT the orientation of three 5' upstream pseudoknots in the 3' terminus of #=GF RT tobacco mosaic virus RNA. #=GF RA Felden B, Florentz C, Giege R, Westhof E #=GF RL RNA. 1996;2:201-212. #=GF WK Transfer_RNA-like_structures #=GF SQ 4 AB354955.1/1390-1455 GUGUCUUGGAUCGCGCGGGUCAAAUGUAUAUGGUUCAUAUACAUCCGCAGGCACGUAAUAAA-GCGA AB083196.1/6281-6347 GUGUCUUGGAGCGCGCGGAGUAAACAUAUAUGGUUCAUAUAUGUCCGUAGGCACGUAAAAAAAGCGA EF375551.1/6292-6357 GUGUCUUGGUUCGCGCGGGUCAAGUGUAUAUGGUGCAUAUACAUCCGUAGGCACGUAAUAAA-GCGA DQ355023.1/6272-6337 GUGUCUUGGAACGCGCGGGUCAAAUAUAAGUGGUUCACUUAUAUCCGUAGGCACGAAAAAUU-GCGU #=GC SS_cons <<<<<<----AAAA<<<<-----<<<<<<<<_____>>>>>>>>>>>>>>>>>>::::::::.aaaa #=GC RF GUGuCUUGGAuCGCgCGGGucAAaugUAuaUGGUuCAuaUAcauCCGcAGgCACGuAAaAAA.GCGA //